CF504133

Overview
NameCF504133
Unique NameCF504133
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length254
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-621 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_C02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504133 ID=CF504133|Name=CF504133|organism=Citrus sinensis|type=EST|length=254bp
TTGAAGTACTTGAGATTAAGGAATTCACCTATAGATAATCTCCCACCCTC
CATTGAAAAGTTGCAGAGACTACAAACTTTGGACTTGTCCCGACACACCT
GTGTGGTATACCGACTGAAATTAGTAAGTTGACAGAATTGAGACATTTGA
TTGGAAATTTCAGCGGGTATTTGCCGATAGAAAATTTGACTAACCTTCGA
ACTCTTAAGTATGTGAGCGTTGAAAGCTGGAATCGGCTTAATCCTGATAA
ACTG
back to top