CF504135

Overview
NameCF504135
Unique NameCF504135
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length357
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2176 contig Csv1_Contig2176:434..790. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-623 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_C05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504135 ID=CF504135|Name=CF504135|organism=Citrus sinensis|type=EST|length=357bp
GAGACACAGGGCAGCAGCTGCCATGGGCGCCGTCGCCGATGGATTGGTGA
CTCGTCCTCTTTTGCCGCTCCCCGTTCTGAAGAAATCCAATAGTTGTAAA
CGAGTTTTCTGCTTGGATTTGAACTTGATGCCTACTGGGGATGATTTGAA
GTTATGGGTCGCTTAGTTAGTTACTTTCATTGTTAGTAATTAGTTTATAG
CCCTTATAAAAAAAAAATAGTTTATAGCCTTTAGATAACTGGCTTTATAA
TTTCATTTTCAGCCCTCTGTATTTACCGATTTATTGTTCGATTTATTGTT
CTCGGATTGACTCATTTATTTGTACACTGCTAAAACAAAAAGATTCTTAT
TATTGAT
back to top