CF504136

Overview
NameCF504136
Unique NameCF504136
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length198
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2433 contig Csv1_Contig2433:934..1130. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-624 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_C06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504136 ID=CF504136|Name=CF504136|organism=Citrus sinensis|type=EST|length=198bp
TAGTGATCCTTTTAGCTTCTTCCGTTAGGCGCCGCTTCTTTTATGTTGCT
TTGGGTTGAATTCTCCATTTTGGCCTTTTTTCCCCCTATATTCTCTTTTT
AATCCTCTCTTTTCTAGTGGGGGTGAGAAGTGTGGTGATCTTTTTGTAAG
ATGAGGTAAATAATGTTGGATCCTCAATGAGAAAGCCTTTTTCTTTTT
back to top