CF504143

Overview
NameCF504143
Unique NameCF504143
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length264
Alignments
Feature NameTypeLocationAnalysis
CF504143_ssr147 microsatellite CF504143_ssr147:147..161.
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-631 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_D03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504143 ID=CF504143|Name=CF504143|organism=Citrus sinensis|type=EST|length=264bp
GCCCAATGCCCTCCAACTAGAATCGGTAATATATATAGAAGAGTTAAAAA
AACACAAAAACAAGTAATTTTATCAGAGGCAAAGAGAGATATTTGTGAGG
TTGTTGTTCACACAACACTCTGACCTACTAAATTCTTATTTATTTACTTG
GCTTGGCTTGGCTGCTTCACAATTCTTTGACACCTATCTTCTGTCTCTCT
TAACCCTTTGAGGATTTTTCTGAGACCCAATGGCGAGTTGGGTTCTTTCA
GAATGTGGCTTAAA
back to top