CF504145

Overview
NameCF504145
Unique NameCF504145
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length387
Alignments
Feature NameTypeLocationAnalysis
CF504145_ssr252 microsatellite CF504145_ssr252:252..269.
CF504145_ssr101 microsatellite CF504145_ssr101:101..112.
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-633 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_D05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504145 ID=CF504145|Name=CF504145|organism=Citrus sinensis|type=EST|length=387bp
AAAAATAAATAAAACGCCACCGGATCACCGTTTATCTTCTAGAACACCGA
CCAGCCGTTGCGTGTATAAAAGCGATTTCCGTTATATACATTTGCACCTG
TTCTTTCTTTCTTCCAAAAGCCCTTGTTTTTCGGTCTCTCCGTCACTAGT
CAACAAAGTACACCTTTTTCCTATTTCAGGTTCCGCCACGTGCCCAGTTG
GATTTATCTGGGATGAATAAAATGAAGAAGAATTCGAGAAACGATAGCAG
TAACAACAACAACAACAACGAACAAGTCTATTGGGAGATGAGGCCAAGTG
GCATGCTTGTGCAGAGAAGGGACGACGATAATTACGATCATCAAGACGGC
GCTGCAGCTTCTGTTTCAGGGGGACCCGTGATCAGGA
back to top