CF504147

Overview
NameCF504147
Unique NameCF504147
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length162
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12769 contig Csv1_Contig12769:18..179. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-635 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_D07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504147 ID=CF504147|Name=CF504147|organism=Citrus sinensis|type=EST|length=162bp
GGAAAGGGTTTTAACTTTCAATCGTTCTACAGTGGCTGAAGCTCTGCGCA
TACGAGCTCTCTGTCTCTCTTACTAATTTTTGTTTGCTACCAGTCTTGTG
AAGGATTTTTCAATTAAGGGGTTCTTAAGTTGCAAAATGTCAGGCGGCCC
TGGGCTTGAGTC
back to top