CF504149

Overview
NameCF504149
Unique NameCF504149
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length332
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-637 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_D09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504149 ID=CF504149|Name=CF504149|organism=Citrus sinensis|type=EST|length=332bp
CTGACTGGTTGAACGATAAAGAAAAATTGAGCTCAGACACAAGACACTGG
AAAGCTATTGTTGACAGGTCTTATCTCACGGGATTGGGTATTGATTGGTC
AAAAATCCGGAATGTAATGGACATGAAATCCATCTACGGAGGATTTGCTG
CAGCACTTGCACAACAGAAAATATGGGTGATGAATGTGGTCCCTGTACAT
GCACCAGATACACTTCCTGTTATTTATGATCGTGGTCTTGTCGGTATCTA
CCATGATTGGTGTGAGTCGTTTGGGACTTACCCCAGATCTTATGACCTTT
TGCATGCTGATCATTTGTTCTCACGTCTTAAG
back to top