CF504277

Overview
NameCF504277
Unique NameCF504277
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length295
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig531 contig Csv1_Contig531:1..295. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-766 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E01 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504277 ID=CF504277|Name=CF504277|organism=Citrus sinensis|type=EST|length=295bp
CTTTCTCCGAGCATTCTTGACTTCCCGTCTCTAGTTCTCAGCCCGGTCAC
CCCTTTGATACCCGACCCGTTTGCCCGATCCGGGCACGGCAATCATGTTA
ACTATAACCATACTGCTTTGCAAGCAAAGGGCGAGAATTTGGATAAAGAA
GCCGAAGAGAAGGCCATTAAAGAGAAGGGGTTTTATTTGCACCCGTCACC
ATCAACTACGCCGCGAGAGGTGGAGCCGAGGCTGTTGCCGCTCTTTCCGG
TGTCTTCGCCGAGAGTTTCAGGTTCTTCCGCTTCTAATTCTTAAA
back to top