CF504278

Overview
NameCF504278
Unique NameCF504278
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length521
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF504278_ssr10 microsatellite CF504278_ssr10:10..33. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-767 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504278 ID=CF504278|Name=CF504278|organism=Citrus sinensis|type=EST|length=521bp
CATATTTCTTCATCATCATCATCATCATCATCAGGGTTTTAGAGTTTTTA
GCAAAATATGGAATCCCTTGCTAAATTACACGGCGGTCACCAACCTCTAT
CTCTTTCATTCAATCATCACCGTCCATCATTCCCCAAATCCATTTCCTTC
ATTTCCCTCCGAACTCCTCCCTCATCATCACCGTTCAAATTCTCCTGCAT
CAGAGCCTCATCCTCACCCGCATCACAACAGAACCCTAAGCCTTCCCTCC
TCCGTACCCTAACTCCTCTCTCTTCACCTCTCATCAAAATCACCTCCGTC
ACCGTAGCCGCAGCCGCATTACTCTTCATGCGCCTCCCTTTCCACAGCAT
CAAACCCGCAATTGCCGCCCCCGTCGCCGCCGCAGCCACTGTGGAATCCA
CTAACGAATCGACAAAGGATACAACATCAGCTCGGGAGGATGTTTCTTAC
GAAGAAAAAGAGAAGGAAATTGAACAGCACCTGGCTGCAAACCCTAACGA
TATCGAAGCTCTACAGACCCT
back to top