CF504280

Overview
NameCF504280
Unique NameCF504280
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length272
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3989 contig Csv1_Contig3989:179..450. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-769 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504280 ID=CF504280|Name=CF504280|organism=Citrus sinensis|type=EST|length=272bp
CAGCTACAACTAGCACTGAAAGGTTGGAGCTTCTAGATGACGAAGAGCAT
ATATTTGGCATGAGAATTGTTGGGGGAGATCATAGGCTCAAGAACTACTC
GTCTATTGTTACGGTCCATCCAGAGGTTATCGATGGCAGACCAGGAACAC
TGGTGATAGAGTCGTTTGTTGTGGATGTGCCTGATGGTAATACCAAGGAT
GAAACATGTTATTTTGTCGAGGCTCTAATCAAGTGCAACCTCAAGTCACT
AGCTGATGTCCTCCCGAGCATT
back to top