CF504281

Overview
NameCF504281
Unique NameCF504281
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length432
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF504281_ssr20 microsatellite CF504281_ssr20:20..31. BLAST: Citrus ESTs to Prunus persica proteins V1
CF504281_ssr54 microsatellite CF504281_ssr54:54..71. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2281 contig Csv1_Contig2281:130..561. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-770 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504281 ID=CF504281|Name=CF504281|organism=Citrus sinensis|type=EST|length=432bp
GGCAACGTTAGCAACAGCCACAACAACAACAGCAGTAGCGGCCTTTGCCT
TCCCTTCTTCTTCTTCTTCTTTTTCGTCAAAATCTCATCAACCCAAATCC
CAAAATCTCTCCTTTTTCTCTTCACAATCTCTCTCACTTCTCTATTCAAA
TAAATCGCCTCTTGTCAAAAACTTCAGCAACCCACCTTCCGCTCTTCCCA
TGGACGCTTCCACATCTGATCACAAAAACACATCCCAGGGGGATCAGGGG
TTGCCTGAGCTTCTGACAGAATACATGGTGGACATGAAGTGTGAGGGTTG
CGTTGATGCCGTCAAGCAGAAGTTGCAGACTGTTACTGGAGTCAAGAATG
TTGAGGTGGACTTGAGCAATCAAGTTGTGAGAATTTTGGGATCTTCACCT
CTGAAGACCATGACCGAAGCTTTGGAGCAAAC
back to top