CF504283

Overview
NameCF504283
Unique NameCF504283
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length255
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12769 contig Csv1_Contig12769:12..266. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-772 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504283 ID=CF504283|Name=CF504283|organism=Citrus sinensis|type=EST|length=255bp
AAAGGAGGAAAGGGTTTTAACTTTCAATCGTTCTACAGTGGCTGAAGCTC
TGCGCATACGAGCTCTCTGTCTCTCTTACTAATTTTTGTTTGCTACCAGT
CTTGTGAAGGATTTTTCAATTAAGGGGTTCTTAAGTTGCAAAATGTCAGG
CGGCCCTGGGCTTGAGTCTCTTGTAGAACAGCAAATATCAGTTATCACAA
ATGACGGACGTAACATAGTGGGAGTCTTGAAAGGATTTGACCAGGCTACA
AATAT
back to top