CF504290

Overview
NameCF504290
Unique NameCF504290
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length442
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7104 contig Csv1_Contig7104:26..468. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-779 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504290 ID=CF504290|Name=CF504290|organism=Citrus sinensis|type=EST|length=442bp
CAAATCTCGCCTAAACAACTTCCCTTCCTCGCCGGAGTTTCGTAACGGTC
ATATCGCCGATCGCTATTTTCCCTCCCTCTCTAAATTTATATCAGCCTTT
TAAATCCATAATTTGGCCTCCGTAATAATCTCAGATCATCCGCACAAACT
TCCGCACTCTCTTTACTGGATGGTAAGCTAAATTGTGGCAGGTTTAAGCA
CGGGTTTAAGGTGAAGGCACAAAATTAGGGTTTCTTGTTTTGTAATGAGT
TTGAAGAATAATGAAGGTTGACTTGAAATTTGTGTGTAAGCAAACGCAAT
GGTAGTAGCTGCAGTATCAACGGCTATAAGCAACACCCCGAACCGATGTC
GACGACGACTCAGAATCCTACTACAAGAACGAGGCCACCTCTTTTACCGT
CAGACCCCGAGAATGGACTTGCTAATCATCGACGCCCTAAAT
back to top