CF504291

Overview
NameCF504291
Unique NameCF504291
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length456
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1074 contig Csv1_Contig1074:425..880. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-780 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504291 ID=CF504291|Name=CF504291|organism=Citrus sinensis|type=EST|length=456bp
CGCAAAAGCATCTGAATTACTCTCGAGTTTTGATTCCGGAAGCAGAGATC
TTTTCAGATATGAAGATTATGGAAACAACCTGCGCAGGTAACGACGATTG
TTTGGAGGGTCGGCCATGGAATTTGGCCAGTATTGTTGATGATAACGTTG
CGAATGACGTCAATCTCGATCTTCTTGCTGTCCCTCAATACGGGAGAAAC
ACTGACCAAACTGGTTAAGTGCAAATAATATTACTCTTTTGTGTTATGCT
TATTCAAATAAAAAGATGGGTACTGTTATTTCCTATTAATGTGGGAGTGT
CTGTTTACTTCAGTTCTACTTAATAAAATATCTTGATATGTATAAAAGTT
TTTCTTTATTTACTATCTTTGGGTGGTGTCTTCCTGGAAAAGGAAATTAC
TGAATAAAATTATTGCGTCTGTTATAAAGTGTTGATTAAAAAAAAAAAAA
AAAAAA
back to top