CF504292

Overview
NameCF504292
Unique NameCF504292
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length416
Alignments
Feature NameTypeLocationAnalysis
CF504292_ssr109 microsatellite CF504292_ssr109:109..120.
Csv1_Contig10190 contig Csv1_Contig10190:676..1091. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-781 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504292 ID=CF504292|Name=CF504292|organism=Citrus sinensis|type=EST|length=416bp
GTTAAGTCGTGGGCTGACGTCGATGACGATGACGATGATGATTACTACGC
CACCACGGCTCCTCCCCCGGTCGCATGGGGATCGTCTGACGCGCCGGCGC
CGAGCCAAGAGGAGGAGGAGAAGCCCGCCAACGTCGAGGAGAGTGAAAGT
GAAGAAGATATCCTAGATGAAGGGGATGACGAGGTAGAGGAAGAGCATGA
TCGTGAACCTGAGGTCCCAGTGCACCATGAGCCTGTGGTGAAGCCTCCTG
AAGTTTCTGTAGTACCTAAGGAGTCAGAAAGGCAACTCTCGAAGAAGGAG
AGGAAGAAGAAAGAACTGGCAGAGCTTGAGGCTCTTCTAGCTGATTTTGG
GGTTGCCCCAAAAGAGGGAAGTAATAGCCAAAATGAATCACATGATGTTG
CACAAGACAAGAAAGA
back to top