CF504299

Overview
NameCF504299
Unique NameCF504299
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length343
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7039 contig Csv1_Contig7039:313..655. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-788 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504299 ID=CF504299|Name=CF504299|organism=Citrus sinensis|type=EST|length=343bp
GGAAGCAGAGAGAAAGAGAGCAGATGGGTCTGCTCACAAACAGAGTAGAG
CGAAATGAGATCAAGGCGGGGGATCATATTTACACTTACAGAGCTGTTTT
TGCTTACTCTCACCATGGTATTTATGTCGGGGGAAGCAAGGTAGTGCATT
TTAGACCTGAACGGAACTTAATTGTGGGAGCGGAGACATCTTCTGAGACA
CAGAATTCAATCCTCCCATCATCCTGTCTGATCTTTCCTGATTGCGGATT
CAGGCAACCCAACAGTGGAGTTATCCTCTCGTGCTTGGACTGTTTCCTTG
GAAATGGATCACTGTATTGCTTTGAATATGGAGTTGCCCCATC
back to top