CF504300

Overview
NameCF504300
Unique NameCF504300
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length373
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8219 contig Csv1_Contig8219:41..413. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-789 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504300 ID=CF504300|Name=CF504300|organism=Citrus sinensis|type=EST|length=373bp
GTTAAAGCCAAAGAGTTCCGAACGGATCAAAGTTTTCTTGTAGGAGAGAG
AAATTTCTAGGGCGAGAAAGCGAGAGAAAAGGAAATTTGGTAGCTTAAAA
TGTTGGGAGTGTTCAGCAGCGCGATCGTTTCACCTCCAGAGGAGCTGGTG
GCGGCCGGAAGCCGGACTCCGTCGCCGAAGACCACATCGACGGCACTGGT
CGACCGTTTCCTCCAGACCAACTCGTCTGCTGTGTCCGTACAGGTCGGGG
ACAACGTCACCCTCGCGTACACTCATCAGAACGAGTCTCCTTTACGGCAA
AGATCATTTGCTGTGAAAGATGAGATCTTTTGCTTGTTTGAGGGAGCACT
TGATAACTTGGGAAGCCTGAGGC
back to top