CF831913

Overview
NameCF831913
Unique NameCF831913
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length253
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01A01_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF831913 ID=CF831913|Name=CF831913|organism=Citrus sinensis|type=EST|length=253bp
TACCTCCAAGAAATCGTGATTTCAGCGGTCTGTGCCAACCCAGTGGATCT
TCGAGTCCCTCGTAACTTACAGTTAGGAGCAAAATGCCGCCGTCCAATGC
GGGGAGGAAACACTTGACGGCGCTGTCCAAGAGGAAAAGGGGGAAAATGG
GTGTTAGGGCACCGGTCATAATCGCCACCTTGTATGATAGAATTTCCACC
AAATGGAGCAGGAGGATCTCTTATAATTGGAAAATGAGGCCTGGTATAAG
GAA
back to top