CF831915

Overview
NameCF831915
Unique NameCF831915
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length279
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01A02_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF831915 ID=CF831915|Name=CF831915|organism=Citrus sinensis|type=EST|length=279bp
TTTAACTGTCAACATCATCAACACCATGAAACTGAGACTGAGATCTCTTG
AAAACAAGGAGACCCTAAGGCTCGAAGTCCCCTCTTCGTGCACTCTTCAC
GAGCTCGGATAAACCCTCTCTCAATTAATTTCGTCGTCGCCTTCTTCTCT
TCGCTTCTCTCTCAACAGGAAGGACGAACTGCTCGCGTCGTCTCCGCCGG
AATCCCTTCACTCCCTAGGTGTCACCGCTGGTGACCATATCTATTATTCT
CGAGATCCCTATGCTTTTGTTTCTCAAAC
back to top