CF831932

Overview
NameCF831932
Unique NameCF831932
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length153
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11045 contig Csv1_Contig11045:789..940. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS02_01A13_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01A13, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF831932 ID=CF831932|Name=CF831932|organism=Citrus sinensis|type=EST|length=153bp
CCAACAACCCATTTCCTCATATCACGTACCGAAGTTGCACCATTAAGCTC
ATACCATGTCTTTTTTCGTTGAATACAATTCACTGATCATGGATGCCATG
ATGATCGGCTATGTGGAGTTGCAATTAATGGTAAATCCCAAAGTGGGGTC
GTT
back to top