CF831934

Overview
NameCF831934
Unique NameCF831934
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length649
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5109 contig Csv1_Contig5109:1..638. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01A15_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01A15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF831934 ID=CF831934|Name=CF831934|organism=Citrus sinensis|type=EST|length=649bp
ACGTTTTTGACTGTTTAACACAGAAGCCGAAGGGAAGAAGACCCTAAAAA
GAAGATGGCGAAGTCAGTGACTTGTCTTGTAATTACGCTCGCCATTTTCT
CCGTCGCGGCTTCGATCGACGAGAAATGCGGAGCCTGCAATGCCGTTGCA
GAGGAGCTAGAGCGTGGACTTTCAAAGGAAAAAACGAGGAATCATTTGGA
TTTGAGACATAGATTGGACTCCAAAGGCCAACGTGAAGGAAAGGTAATCG
ATTACAGAGTAAGTGAGCTTCGAGTTGTTGAGCTATTGGATGGACTTTGT
GATAAGATGCAAGACTACACTCTGGAGAAGATAGATTCCACCAGACAAGA
TTGGATCAGAGTAGATAATTGGGAAAACCTTTCCATTAGTAAACAAGAAG
CTAAAGCATATGCTAATGATATTTCTACTTATTGTGGAAGGTTACTTGAG
GAAACTGAAGATGAGTTGGCAAAATTGATAAAGAAAGGATCACTTAGAAC
AGGAGATGTAAGCAAGGGTCTATGTGAAGATTTGAGCAAGCACTGCAACA
AGTCAAGTGGCTCGCAGAGACTGGAATATTACAGTAATGAATCTTATGGA
GAACTTTGAGCTTCCATGCTTATTGCTTCATCAGAAGAAAAGAGTTGAA
back to top