CF831937

Overview
NameCF831937
Unique NameCF831937
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length253
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:324..576. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01A18_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01A18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF831937 ID=CF831937|Name=CF831937|organism=Citrus sinensis|type=EST|length=253bp
TTTTTTTTTTTTTTTTTGTTGACACACACAATAACTTTTATTGACTTATT
TCCTTTTTCAGGAAAATACTTAGCTCAAAAGTAAACCAAAAGATTGCTTG
TACGTCTCAAGAAATCTTATAAGTTGAACTAAACCATACTAAAACATTGT
CATGATTGATAGGTAATAGTATACCTATCATTTATTTAATTAAACAAAAC
AGAAAAAAAAAAAAGCAGTGCTGCACTTAACCCATGTAGTCGGGGTTTCT
TCC
back to top