CF832073

Overview
NameCF832073
Unique NameCF832073
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length547
Alignments
Feature NameTypeLocationAnalysis
CF832073_ssr455 microsatellite CF832073_ssr455:455..464.
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E08_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832073 ID=CF832073|Name=CF832073|organism=Citrus sinensis|type=EST|length=547bp
ACGATTAATGAGCTAAATAATTGAATCTTCTTTGAGCCTTCTTTTCTTCA
GCTAAGAAAGAGCTATCTAGCTAGCATTAATTCCCCATAATCTCTCACTA
GGGCCAATGATAGTTATTATAAGCTCACTTTCAGTGCTGCCTTTCTTTTT
GCATTGATTTTTTCACATGGAATCATCTCCACCGAGCAAAGGCTTCTAAA
AGATTGTGGAGATGATGGTGATGTGCGCCGCAACCTTTTGGGAAATGCTG
GATCAGGTGCTGGTAAAAGCCCTGGTGTTGGCAACGTTGCAGCACAGGAT
GATTTCCGTCCGTTGACACCAGGTCACAGGCACAGCCCCGGTATCCCCAG
ACTTTCAGCGGATAGTGACGACTTCCGTCCCACCACTCCAGGCCACAGTC
CCGGTGCCGGCCAGCTCTAGGGGACCCACCAGCGTTGGTCTTCCTAATTA
ACCGATATATATATGGATGTATTGTGAAATAACTAATATTAGAAAGCATT
TGGTAATTCGCCGTATGTAATAATTGTAATGTAAGGGTTCTATCCGG
back to top