CF832079

Overview
NameCF832079
Unique NameCF832079
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length752
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF832079_ssr102 microsatellite CF832079_ssr102:102..111. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig8054 contig Csv1_Contig8054:89..840. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E11_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832079 ID=CF832079|Name=CF832079|organism=Citrus sinensis|type=EST|length=752bp
AGGGGACAATGGAACCGGTGAAGGAAGAGGAAGAAGTTTACAGCTGGAGA
GAGGTGAATCTGCCGACTCTGTCGCCCACGGCGGCAGCAGAACCAGAGCT
TGAGAGAGAGACAGGGGAGAGAAGGAGAGGCAGAGACATATTGATAGCCG
TCGATCATGGTCCCAACAGCAAGCACGCCTTCGATTGGGCCCTCATCCAT
CTCTGCAGACTCGCTGACACCATCCATCTTGTCCATGCTGTTTCCAGTGT
GCAGAATCAAATTGTTTATGATATGAGCCAGGGGCTGATGGAGAAGCTTG
CTATAGAGGCTATGGATGTTGCTATGGTGAGGACTAAGGCTCGGATTGTG
GAAGGGGATGCAGCTAAGGTAATTTGCAAGGAAGCTGAAAGGTTAAAACC
AGCAGCTGTGGTGATTGGTAGCCGAGGCAGAGGCCTAATACAGAGTGTAC
TGCAGGGAAGTGTGGGTGAATATTGTTTACACCATTGTAAAACTGCTCCT
ATTATAGTTGTTCCTGGAAAAGAAGCTGGAGATGCATCATTGATATGATG
GAACCAGATACACTTTTGGGGATCTGTAGGTCATGAACTTTGTGTGCATT
GTGTGATCGTTCAATTGATTGTTTTTATTAGCTAGTGTTAGGAAGAAAGC
TGCATGGAAGAATGTCTGTAATATCTAAAGAAGACTTCATTGTCCTTTTT
TTTCGTTGTTGATACTTTACTTTTGATTATTTGTAATTTAAGTATCTGAT
GG
back to top