CF832085

Overview
NameCF832085
Unique NameCF832085
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length779
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10185 contig Csv1_Contig10185:605..1374. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E14_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832085 ID=CF832085|Name=CF832085|organism=Citrus sinensis|type=EST|length=779bp
TTTAGGGGAAACGCTATTCTATACTTCATATCTTGCACCATTGTTTGTAT
AAGCATATACTACAAAAGGACAAGCTCTAGGAAAAACGAAAATAAACAAA
GACGGGATTAACTTATCTAAAACCATTTTACATGATACTACAACTATTAG
CATTCTCATCACTGAAGTAGTGAGTGTAATGATCACCAGCAGCTGGCCCC
AGCATCGGCGGCGGTGCTCCATAGTTGAACGGTGGAGGCTGCCTAGCATA
CATCATAGGATGATACATCTCATTCCCTCCATTCATCTGCTGTTGATTCA
TCATCATACCCATATATTGTTGTTGGTTGTAAGGATTAGTGCCTGGGCCC
ATTGCTTGGTAATATCCTCCGTTCATTGGTGGCGACGCTGGTAATCCTTG
CACCGCCGGAAAACCACCCATCTGGCCTGTTGGGTAATTTCCCATCTGGC
CCATTGGATAGTTACCCATCTGGCCCATCGACCGCATTGGTCCCATCTGG
CTCATTGGACCCATCTGGCTCATTGGACCCATCGGGCCCATATTCTTGGC
CCCACCACCATGACCATTAGCCTTGCCACCTTTACCTCCATGATTGGCTT
TAGGCACATCGAAATCAAATACATCATCTTTCATTTTCTTCATATCAAGG
ACCCCATCATATTCATTCTTGCCTCCACCTTTCTTGGGCCCATTGCCTTT
ATTTTTCCCACCAGCTCCGCTGCCATTCTTGCCATTCTTGTTACCACTAT
CCCCACTACCTTTATCCTTTTTACCAAAA
back to top