CF832090

Overview
NameCF832090
Unique NameCF832090
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length595
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF832090_ssr329 microsatellite CF832090_ssr329:329..343. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1004 contig Csv1_Contig1004:1..595. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E18_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832090 ID=CF832090|Name=CF832090|organism=Citrus sinensis|type=EST|length=595bp
TTTTTTTTTTTCTTTTTTGCTGAAACCCACCACTTACGCTTCTCACAATT
TGTCCTACGCCAAGAAAGTCTCTGGTCATTCTATCTGATCCACCCATGCC
TGCGTTCATATTATGGTGCAGCTTTGCTTCATAATTAGGGTGATGATGGT
GGTGGCGGCGGTGGTGGTTTTGATCTTGCCCGCTAAATGCATTGACTTGA
TCATTTGACCCAGTTCCGAAAATCGATGAATTGGTGGCTGCAAATGGGTT
CATTAGGTCATGGATGCTGCTGCTGTTATCATTTTCTGATGATCCGGGCC
CACCAAATACGTTACCAACACCACCAAAGTTGTTGTTGTTGTTATTAGGT
TTTGAGCCACTTGAGGACGAGCTTCCGCCGAAACTCCTTAGCAACGAAGC
AGTGTTGTTGTTGCTTGAAGTTGAGCCCATTTGAGCAGCCTTTTGAAGAA
GTGCTGTGGCTGACATGTGGGGGACCATGGTCTCATTTTGATGCACTGAT
GAGGTACTGAAGAGTGAGGGGACAGCGCCGGAGCTGATTTGATGATCGCT
GATTAAGTTGTTCGTGAAGAGATTATTGTTCGTTCCTTGATGATG
back to top