CF832418

Overview
NameCF832418
Unique NameCF832418
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length635
Alignments
Feature NameTypeLocationAnalysis
CF832418_ssr208 microsatellite CF832418_ssr208:208..223.
CF832418_ssr15 microsatellite CF832418_ssr15:15..26.
CF832418_ssr316 microsatellite CF832418_ssr316:316..327.
CF832418_ssr489 microsatellite CF832418_ssr489:489..506.
Csv1_Contig13688 contig Csv1_Contig13688:173..807. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01N10_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01N10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832418 ID=CF832418|Name=CF832418|organism=Citrus sinensis|type=EST|length=635bp
TTTTTTTTTTTTTAAATAATAATAATAACTAATCTCTTTTATCCTATAAT
TGATAATGGAAATTCACATTGACAAAAGGCAAATTACACACTGACTGGGC
AAAATAAATAAAAAAAAAACAGAGTCTCTCAAAAGCAATAATAATTTAAA
CACAACACCACCTTGAGTAGACACCCCAAAAATAAAGCAGCAAGCTCTTA
CTGTGACCACACACACACACACACCAAATTTTTATTATAGAATAAATCTA
AAATGATGGATGATGATGCTGATGTTGATGCGTCACATAAAAGTTAATTA
ATTTAATCGCTGTCACTGCTGCTGCTGCTCTCGTGTCCGTCCTCGTGCTT
CTTCTTCTCCTTCTTCTTTTTCTTCTTCTCTTCACCGTGGGCGGCGCCCT
CGCCGCCGCCGACACCGGGGATCTTCTGCTTGATCTTGTCCACCAAGCCC
TCCTTGTGTTCGCCCTCCCTGTGTTCCCCGCCGTGATACTGCTGCTGCTG
CTGCTGATGGTGAACATCAGTAGTACCGACACCGGGGATCTGCTGCTTGA
TCTTGTCCACCAAGCCCTCCTTGTGTTCGCCGCCGTGATACTGCTGCTGA
TGGTGAACATCAGTAGTGTGGTGGTCACCACTATG
back to top