CF832419

Overview
NameCF832419
Unique NameCF832419
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length644
Alignments
Feature NameTypeLocationAnalysis
CF832419_ssr417 microsatellite CF832419_ssr417:417..432.
CF832419_ssr134 microsatellite CF832419_ssr134:134..151.
CF832419_ssr312 microsatellite CF832419_ssr312:312..323.
CF832419_ssr613 microsatellite CF832419_ssr613:613..627.
Csv1_Contig13688 contig Csv1_Contig13688:171..811. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01N10_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01N10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832419 ID=CF832419|Name=CF832419|organism=Citrus sinensis|type=EST|length=644bp
CCATAGTGGGGCACCTTCACACTACTGATGTTCACACATCAGCAGCATTA
TCACGGCGGCGAACACAAGGAGGGCTTGGTGGACAAGATCAAGCAGCAGA
TCCCCGGTGTCGGTACTACATGATGTTCACCATCAGCAGCAGCAGCAGCA
GTATCACGGCGGGGAACACAGGGAGGGCGAACACAAGGAGGGCTTGGTGG
ACAAGATCAAGCAGAAGATCCCCAGTGTCGGCGGCGGCGAGGGCGCCGCC
CACGGTGAAGAGAAGAAGAAATAAGAAGAAGGAGAAGAAGAAGCACGAGG
ACGGACACGAGAGCAGCAGCAGCAGTGACAGCGATTAAATTAATTAACTT
TTATGTGACGCATCAACATCAGCATCATCATCCATCATCTTAGATTTATT
CTATAATAAAAATTTGGTGTGTGTGTGTGTGTGGTCACAGTAAGAGCTTG
CTGCTTTATTTTTGGGGTGTCTACTCAAGGTGGTGTTGTGTTTAAATTAT
TATTGCTTTTGAGAGACTCTGTTTTTTTTTTATTTATTTTGCCCGGTCAG
TGTGTAATTTGCCTTTTGTCAATGTGAATTTCCATTATCCATTATATTAT
AAAAGAGATTAGTTATTATTATTATTATAAAAAAAAAAAAAAAA
back to top