CF832421

Overview
NameCF832421
Unique NameCF832421
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length364
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:35..398. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01N11_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01N11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832421 ID=CF832421|Name=CF832421|organism=Citrus sinensis|type=EST|length=364bp
GTTTTGAATACGCGTTCAGTCGAAGCCAGCAGAAATCTTTTGCCTTCCTG
ATTTGAAGATTATGGGAACTCCTTGCGCAGGTTATACCGATTGGTCGGAG
GGTGGGGCCCCCCCATGGTTTTCACTTATTGCTGATGATGAAATTAATGG
AAATATTGATCTTCTTGTAGTCCCACAATATGGAAGAAACCCTGATCACA
CTGGTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTTTAAGAAAATA
AAAGTATGGGTACTGTTATTACCCGTCAATTGTACGATGGTCTCAGTTTG
GTTCAGTTTAACTTGTAAGATCTCTTGATATATACAAGAGATTCTCTTTG
TCTAGCAAAAAAAA
back to top