CF832428

Overview
NameCF832428
Unique NameCF832428
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length105
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01N15_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01N15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832428 ID=CF832428|Name=CF832428|organism=Citrus sinensis|type=EST|length=105bp
TTTTTTTTTTTTTTTTTCACTGATAAACAACTTTATAAGTTGAACCCTCA
CAATGTAAGTTCTACAAGAAAATTTGGGCTGCAGCCCTAGTCAAAGCGAT
CATTA
back to top