CF832443

Overview
NameCF832443
Unique NameCF832443
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length841
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF832443_ssr577 microsatellite CF832443_ssr577:577..588. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig9919 contig Csv1_Contig9919:271..1112. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01N23_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01N23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832443 ID=CF832443|Name=CF832443|organism=Citrus sinensis|type=EST|length=841bp
TTTTTTTTTTTTTGTGCTTTTGCTCTCCCCAGAGGCATTCTCCTCCTTTT
CACAACCCCGTTATCTTCTCCTTTCTTCTCTTGCACAACACCATGGGATC
CATCTTGGCCACTCTCCTTATTCAATCCCATCTCAGCAAGAAGGGCATCA
AGTTCTTCAAGACCCTTTTTCTTCAATTCCTTCTTTGAAAGCTGCCTTTC
TGAATCTTTTTGTACTGAAGGAGCTTCAGGAGGGTTTTTAACTATTGGCT
GCTCCACTTCTACTGGTTTTTCAGGTTCATTGTCATGTTCTTCCTCAACA
TCCTCATCAACTTCATCAAGACCTTCTTCCTCACTGTCACTTTCCTCAAC
AGCAGGCTCCTGTTCCTGGGTCTCTTTCTTGTCGTCGGATTCCGCAGCGG
CCCAAACGGATTGAGGCGGCGCGGTAGTAGCATAGTAATCGTCATCGTCC
TCGTCATCCACGTCAGCCCATGATTTAACGGTGAGCGGCGTCGGGGCCCA
AAAAACCTCCTTCTGTTTCTCCTTCTCGTCAGTTTTGGCTTTGCTCTTCG
ATGAACCTGACTCTTTCTGCGTCGATTTCTTCTTCTTCTTGAAACTCCCT
AGCGCCGCAAATACGTTCGTGCTGTTTATCACCAAAGATTCGTCCTTTCT
GCCTCCCACCATTATCGAAACTTTCTATAGAGGGGGCAAAACTGGAAATT
TAAATCCTCTGAGAGAGAGTTTTTACAAATACACAGAAACAGACGATAGG
GTTAATAAGACAAAAACAAACGATCTGGTTATTGAAATTATTCTTTTCAA
TGAACAAATATACAAAACGACGTCCGATGAATGCGTTTCTA
back to top