CF832460

Overview
NameCF832460
Unique NameCF832460
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length433
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:140..572. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS02_01O08_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01O08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832460 ID=CF832460|Name=CF832460|organism=Citrus sinensis|type=EST|length=433bp
AAGCAACTTACCTATCTTTCGAACTTTGATTCCCGTAAGCAGAGATCTTT
CTGATTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAG
GGTCTTCTGCTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCATGAA
CGACAATCTTGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACT
ACATGGGTTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATT
AAATAAATGATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGT
ATGGTTTAGTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTT
TGTTTACTTTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAA
AAGTTATTGTGTGTGTCAAAAAAAAAAAAAAAA
back to top