CF832461

Overview
NameCF832461
Unique NameCF832461
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length205
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9802 contig Csv1_Contig9802:929..1133. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01O09_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01O09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832461 ID=CF832461|Name=CF832461|organism=Citrus sinensis|type=EST|length=205bp
TTTTTTTTTTTTTTTTTGGAGAGACTCATTGATCCATGTTGGATCCCTCT
TATTTAATTTACTTACAATAAGAGCGTAACAAACTAACAATTTAGTTGTC
CACCTACAAGTGTGACATCTAAAGTTTTTATTAAGTAGCTTTTATTAAGC
TTATTTTACTAAAACGTTGATCATGATGATCACATAGATTGTGCCATCAG
ATTAA
back to top