CF832520

Overview
NameCF832520
Unique NameCF832520
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length700
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS02_01P19_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01P19, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832520 ID=CF832520|Name=CF832520|organism=Citrus sinensis|type=EST|length=700bp
CTGAATCCACCCTCTTTATTTCTGGTAAAAAAAAAAATGACACGTAATCG
TGCCCTAAAAGTACAATTCCTGGATGATCAAAAACATCCAAACATGTTTT
TCGTTTTGGAAGTTTTCATAGAAAAGCATTTAAAAAAAAAAATCTCTTTA
AAACCAAAGTGGATGAGCACAGCTATATGCCTGAAACCTGCACCATGATT
TGACCTTAGCATTTTGCGCGGTCTCCAAAAATTATTGAAATTGAAAAGCA
CCCATTTCCTACTAATCCCGCAAATAAACAATATATCTGGTACTCCGGTG
ATATTGAATCTCAAGAGGAGAAGCCTATCCTGGATTAATCACACTCAAGC
TGTTTTTGGCACTTTATCTTGCATCACGTTATCAGGAAGTATGAGCTCAG
CAGGGGTTTCGCGAACAACACCAAGCATTGAATCATACTCCTCATCACGA
CGAGCAAATTTCTTGCGAAGCAGCTTCTCAAACTCAATTTCGTCAAAGCT
CTTCGCATTTTCAGCTGCGTGAACCCGTGCCAAATTGGAATAATTTATGG
CTGACTGGGAAATAAAGGCCATCTCTTCTTCTGTGAGCTTTCTGAGGAAC
CTAGCTGGATTACCTCCCCAAACCTCCCCACATGGAATCTTTGTGTTCTG
CCTTACAAGAGCTCCAGCAGCAACCATAGCATGTTTCTCAACATAAACAC
back to top