CF832527

Overview
NameCF832527
Unique NameCF832527
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length846
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5002 contig Csv1_Contig5002:211..1056. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_02A02_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa02A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832527 ID=CF832527|Name=CF832527|organism=Citrus sinensis|type=EST|length=846bp
GGCCCCCTTTTTTTAATGCACATAGCTTCTAATATATATTCCAGCTCAAG
GGAACACCATATTATCGGAACTGTCAAACATTGATTCCATGTCTTTATAG
ATGTAGTTTATGCAGTTTAAACATAAGAGTACCCAAAAGTTGAAATATTC
TCCCGCAGACTGGACTTTAAACAACAACAAAAAAGATTGGACCCGTTAAC
TTTCCGCTACATAAGGATTCAGGAATTAACCAACTCTTAAGGAATCTCCT
CTTTTTCTCTGTGAAAGAAAAAGGATAGCTGCCGAAGGCAACCAGATGAT
TGTGCAGAATTCTGTGTCAAAGTAGCTTTCAATCATCTGTAGCCTTGGGG
GAATTTTCCGGGGTCTTCAAAACTGCTGTGGTTTTATCTTTATGAGCGGC
AACAGCTGTCCGAAACTCTTCCACTATGGAAGCATCCCTGAACTTCAGTG
CGAATGTAGAAAGACCACTCTTTCCTTCAGTAGCACTGTTAATGCAGGCA
AAAGTGATGCCTTTCTTATCCATATTCGTGAGCTTCATGTCTGAGTAGAG
GCTTGCATTCAAAATCAACCTGTAATTTCCCCTAGCTCTCATGAGAAGTC
TGGCTCTCCCCGTTGCATTTGTGGACACATTCACCTTAAGTTCTCCCTTC
CCACGCTCCTTCCATGATCCATCAAGAAACTCAAAAAGCACTGAATCAGC
AGAGAAAACCACTTTCTCATTCTCCTCTCCGGTCTCAACCACAACTTCCT
GCATAGATGGGAAAGTAGTTCCCTCACTCTTTGAAGCAATAGAAGTCGCT
GGTGTGTTAAACAGGGAAGAATTCCCATTGTTAACCTGTCCAAAAA
back to top