CF832539

Overview
NameCF832539
Unique NameCF832539
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length113
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_02A09_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa02A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832539 ID=CF832539|Name=CF832539|organism=Citrus sinensis|type=EST|length=113bp
GCCGCCCTTGGCCGATTACAATATCCAGAAGGAATCAACTCTTCCCCTAA
AGCTTCGTCTCCGTGGGGGCATGCAGATATTCGTCCCTTCCCTAACGGGA
AAGACGAATATCT
back to top