CF832541

Overview
NameCF832541
Unique NameCF832541
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length199
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_02A10_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa02A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832541 ID=CF832541|Name=CF832541|organism=Citrus sinensis|type=EST|length=199bp
TTTTTTTTTTTTTTTAATAGAATACACATGAAGTAAAAAATAATACCCGG
TACAATAAGCACTACACCATGCCTACCAAAAGAAAAAATAAAAAACCATC
AGGCAAAGACAACATCGAGGCCCAATTTTAAACCCAATGGCGGAAGCTAT
GCCTATACATAACGATCCACTTACAGGTTTTAAATTAGAAAAAGAAGCC
back to top