CF834300

Overview
NameCF834300
Unique NameCF834300
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length690
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11937 contig Csv1_Contig11937:207..896. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_05E16_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05E16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834300 ID=CF834300; Name=CF834300; organism=Citrus sinensis; type=EST; length=690bp
CTTTTTGCCCTCCTTTTTAATGTTTATTTACGACTGTACCACTCGACTTA
TACGTTAGCTTCCGGTGACTGGGAACCTGAGAGCCTCAGCTCCTCTCCAG
CTCTCGGTTTCCCCCGCCTCTGGTTCTTCCGTTACCGCCGCTTGAGGTAA
CAGGTTAAAGAAAAATCAAGAACTAAATAGAATTTTCATCAGCTTTTTTC
TTTATTACAATAAGGTTATTTGCATATTTGATGCCGAATACTAAGAGTCA
CCGGAGAGGAGTACAGGAACCGAGCCGGAGAGCAAAGTTATCGGAGAAAT
CGTCGTCGTTTCACGGGGGAATCCCGGCCACTATGCAGACGTATCAGAAG
GAGCTCAGAAGGCCGAAGACTTTACCGGATTTGCTTCAAGATCGTAGCCT
TGTGTGTCTGTCACCGGAAGCGAGGCCGAAGAAGCTGACGAAGCTGTTGT
TGAACGTCACGGTTCAAGGAAGCGTCGGTGCATTGCACGTGATAATGTCG
CCGGAAAACACCGTCGCCGATCTTGCTGCCGCCGCCGTCAAGCGGTACAT
CAAGGAATGCCGCCGGCCGATCTTGCCGACCACCGATCCGTCCGGCTTCG
ACCTCCATTACTCTCAGTTTTGCTTGGAAAGTTTGGGGAGAGAGGAGAAG
CTGATGGAGTTGGGGTCCAGGAACTTCTTTTTATGTCCCA
back to top