CF834318

Overview
NameCF834318
Unique NameCF834318
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length620
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF834318_ssr168 microsatellite CF834318_ssr168:168..179.
Csv1_Contig2790 contig Csv1_Contig2790:61..680. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS02_05F07_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834318 ID=CF834318; Name=CF834318; organism=Citrus sinensis; type=EST; length=620bp
CCCCTTTTTTTTTTTTTAAGCCTCTAAAATGTACTCATTTATTCATAAAT
ACTTCCCCTTTAAAAAAGAAGGATTTTTTTTGTGAACAAGCAGCTTCCTT
TGCACTTACAAAACAAAGAAAAAAGGAAAAACAGAATGAAGCTTACATCG
CATAAATGTAAGCAAGATTATTTATTTATTGAGATACAGATACAAATTTA
TTATGGAGCTTCAGTTTTGAGGCTCGGTTTCAGGCTCCGTATCAACAGCC
TCACCAGCGTAAGTGCAGCACCTGCAGCCTCCATGATAACCATGTCCACA
GCAACCGTAGCGGCAGTGGCCACCGCCATGGCCCCCACCACCGCCATAGC
CCCCACCACCGCCATAGCCCCCACCACCTCCATAGCCACCACGGCCACCG
CCGTTATAACCTCCACGGCCACCGCGGTTATAACCTCCACGGCCGTCCTC
AATTTCATGTGTCTCTGTGGCCTTATCAGCCTTTTCGTTGTGATCAATGG
AAGTCTCGGCCAGGTCTCTGGCTGCTACCTCGGAAGAGATAAGAAGAGCA
ATGGCCATTAAAAGGCCTAAAAGAAGGAACAATTTGGAACCCATTTTTCT
TTTTCTTGCTTGAAAAAACT
back to top