CF834319

Overview
NameCF834319
Unique NameCF834319
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length617
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF834319_ssr441 microsatellite CF834319_ssr441:441..452.
Csv1_Contig2790 contig Csv1_Contig2790:61..677. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS02_05F07_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834319 ID=CF834319; Name=CF834319; organism=Citrus sinensis; type=EST; length=617bp
TAGTTTTCTCACGCTGAAAAAGAAAAATGGGTTCCAAATTGTTCCTTCTT
TTCCGCCTTTTAATGGCCATTGCTCTTCTTATCTCTTCCGAGGTAGCAGC
CAGAGACCTGGCCGAGACTTCCATTGATCACAACGAAAAGGCTGATAAGG
CCACAGAGACACATGAAATTGAGGACGGCCGTGGAGGTTATAACCGCGGT
GGCCGTGGAGGTTATAACGGCGGTGGCCGTGGTGGCTATGGAGGTGGTGG
GGGCTATGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCCATGGCGGTG
GCCACTGCCGCTACGGTTGCTGTGGACATGGTTATCATGGAGGCTGCAGG
TGCTGCACTTACGCTGGTGAGGCTGTTGATACGGAGCCTGAAACCGAGCC
TCAAAACTGAAGCTCCATAATAAATTTGTATCTGTATCTCAATAAATAAA
TAATCTTGCTTACATTTATGCGATGTAAGCTTCATTCTGTTTTTCCTTTT
TTCTTTGTTTTGTAAGTGCAATGTAAGCTGCTTGTTCACAAAAAAAATAC
TTCTTTTATATAAAAGAAGTATTTATGAATAAATGAGTACATTTTTAGAG
CTTTAAAAAAAAAAAAA
back to top