CF834337

Overview
NameCF834337
Unique NameCF834337
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length239
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_05F21_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05F21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834337 ID=CF834337; Name=CF834337; organism=Citrus sinensis; type=EST; length=239bp
TTTTTTTTTTTTTTTTTAGCACAAGAAAACATTATCAATTTATGCGTTAA
AATCACAGGAAATTTAGCGACCATTAGGCGGAAAAGGCCTTAAAAAACAA
AAACAAAAGCATAAACAGTTTTTCAGTTATAGTTTTGATCAAAACCACTC
AAACCGAAGTTGCCAAGCTTTTTATTGCTCCACCTAATATGAAAAAACCC
TAAAACTATGAATGAGAATGTGCCAACCGAATGTTCACC
back to top