CF834591

Overview
NameCF834591
Unique NameCF834591
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length351
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_05M17_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05M17, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834591 ID=CF834591; Name=CF834591; organism=Citrus sinensis; type=EST; length=351bp
TTTTTTTTTTTTTTAGCTAGACAAGAGAATCTCTTATATATATCACGAGA
TCTTACAAGTTAAATTGAACCAAATTGAGACCATCATACAATTGACGGGT
AATAACAGTACCCATACTTTTATTTTCTTAAACATAACATAAGAGACTAA
TACTGCATATTCTTAACCAGTGTGATTAGGGTTTCTTCCATATTGCGGGA
CCACAAGAAGATCAATATTTCCATTAATTTCATCATCAGCAATAAGTGAA
AAAGTTGTGGCTATAAGCCCCTCCGACCAATCGGTATAACCTGCGCAAGG
AGTTCCCATAATCTTCAAATCAGGAAGGCAAACGATTTCTGCTGGCTTCG
A
back to top