CF834592

Overview
NameCF834592
Unique NameCF834592
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length370
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_05M17_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05M17, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834592 ID=CF834592; Name=CF834592; organism=Citrus sinensis; type=EST; length=370bp
CCCCGGGCTGCAGGGTCGAAGCCACCCCTATATAGTTTGCCTTCCTGATT
TGAAGATTATGGGAACTCCTTGCGCAGGTTATACCGATTGGTCGGAGGGG
CTTATAGCCACAACTTTTTCACTTATTGCTGATGATGAAATTAATGGAAA
TATTGATCTTCTTGTGGTCCCGCAATATGGAAGAAACCCTAATCACACTG
GTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTTTAAGAAAATAAAA
GTATGGGTACTGTTATTACCCGTCAATTGTATGATGGTCTCAATTTGGTT
CAATTTAACTTGTAAGATCTCTTGATATATATAAGAGATTCTCTTTGTCT
AGCTAAAAAAAAAAAAAAAA
back to top