CF834594

Overview
NameCF834594
Unique NameCF834594
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length355
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_05M18_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05M18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834594 ID=CF834594; Name=CF834594; organism=Citrus sinensis; type=EST; length=355bp
GTCGAAGCCAGCCCTTATCGTTTGCCTTCCTGATTTGAAGATTATGGGAA
CTCCTTGCGCAGGTTATACCGATTGGTCGGAGGGGCTTATAGCCACAACT
TTTTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGT
GGTCCCGCAATATGGAAGAAACCCTAATCACACTGGTTAAGAATATGCAG
TATTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTA
TTACCCGTCAATTGTATGATGGTCTCAATTTGGTTCAATTTAACTTGTAA
GATCTCTTGATATATATAAGAGATTCTCTTTGTCTAGCTAAAAAAAAAAA
AAAAA
back to top