CF834608

Overview
NameCF834608
Unique NameCF834608
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length482
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_05N03_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa05N03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834608 ID=CF834608; Name=CF834608; organism=Citrus sinensis; type=EST; length=482bp
GAAGTTACATCGCATAAATGTAAGCACCCTTATTTATTTATTGAGATACA
GATACAAATTTATTATGGAGCTTCAGTTTTGAGGCTCGGTTTCAGGCTCC
GTATCAACAGCCTCACCAGCGTAAGTGCAGCACCTGCAGCCTCCATGATA
ACCATGTCCACAGCAACCGTAGCGGCAGTGGCCACCGCCATGGCCCCCAC
CACCGCCATAGCCCCCACCACCGCCATAGCCCCCACCACCTCCATAGCCA
CCACGGCCACCGCCGTTATAACCTCCACGGCCACCGCGGTTATAACCTCC
ACGGCCGTCCTCAATTTCATGTGTCTCTGTGGCCTTATCAGCCTTTTCGT
TGTGATCAATGGAAGTCTCGGCCAGGTCTCTGGCTGCTACCTCGGAAGAG
ATAAGAAGAGCAATGGCCATTAAAAGGCCTAAAAGAAGGAACAATTTGGA
ACCCATTTTTCTTTTTCTTGCTTGAGAAAACT
back to top