CF834871

Overview
NameCF834871
Unique NameCF834871
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length392
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06E07_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06E07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834871 ID=CF834871; Name=CF834871; organism=Citrus sinensis; type=EST; length=392bp
TTATTGATTTCCCCTTTTTTTTCCCGAAAATACTTAGCTCCAAAAGATAT
CTTGCCCATCTCAAGAAATCTCATAAGTTGAACTAAACCAGACTAAGACA
TTGCCATGATTGATAGGTAATAGTATACCTATCATTTATTTAATTAAACA
AAACAGAAAAAAAAAAAAAGCAGGGCTGCACTTAACCCATGTAGTCGGGG
TTTCTTCCATATTGAGGGACATTAAGAAAATCAAGATTGGGGTTCATGAC
ATCATCATCAGCAATACTGGTCCAAACATTAAACCAACCCTCTGACCAGT
TATTACCTGCCCAGGGGGTTTCCATGTTCTTCAAATCAGAAAGATCTCTG
CTTACGGGAATCAAAGTTCGAAAGCAGTTAAGTTGCTTTTTC
back to top