CF834872

Overview
NameCF834872
Unique NameCF834872
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length428
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06E07_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06E07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834872 ID=CF834872; Name=CF834872; organism=Citrus sinensis; type=EST; length=428bp
CGAAAAAGCAACTTATCTACTTTCGAACTTTGATTCCCGTAAGCAGAGAT
CTTTCTGATTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGTC
AGAGGGTTGGTTTAATGTTTGGAACAGTATTGCTGATGATGATGTCATGA
ACCACAATCTTGATTTTCTTAATGTCCCTCAATATGGAAGAAACCCCGAC
TACATGGGTTAAGTGCAGCACTGCTTTTTTTTTTTTTCTGTTTTGTTTAA
TTAAATAAATGATAGGTATACTATTACCTATCAATCATGGCAATGTCTTA
GTCTGGTTTAGTTCAACTTATGAGATTTCTTGAGATGTACAAGATATCTT
TTTGAGCTAAGTATTTTCTTGAAAAACGAAATAAATCAATAAAAGTTATT
GTGTGTGTCAACAAAAAAAAAAAAAAAA
back to top