CF834876

Overview
NameCF834876
Unique NameCF834876
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length113
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06E10_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06E10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834876 ID=CF834876; Name=CF834876; organism=Citrus sinensis; type=EST; length=113bp
GCCAAACACACACTATTTTTTCTATTAGCTAGGTTAAATTAAATACTTTG
TGAGAGCAATGGCATCATTGAAGGCTGAGAAACCTGTTGGTACCCAACTC
TTTGGGCAGACCA
back to top