CF834939

Overview
NameCF834939
Unique NameCF834939
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length174
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF834939_ssr104 microsatellite CF834939_ssr104:104..121.
Csv1_Contig12881 contig Csv1_Contig12881:1351..1523. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_06G07_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06G07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834939 ID=CF834939|Name=CF834939|organism=Citrus sinensis|type=EST|length=174bp
GTGAACTGAACTAAATTGACACTCTTATAATTGATAGATAATAGCTGTGC
CCATCTTGTTATTTAATTATATATATCATCTTCCATATTGCCTCTTCCGC
TTCCTCTCTCTCTCTCTCTCTTTATCTCTCCGGAGGGAGGGAATTTCTCT
TGTGACTCCAATAAAGAGCCGTTT
back to top