CF834953

Overview
NameCF834953
Unique NameCF834953
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length255
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06G18_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06G18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834953 ID=CF834953|Name=CF834953|organism=Citrus sinensis|type=EST|length=255bp
TATAGTTANAATTTTTTTAATTATTGGTGATGATGAAATTAATGGAAATA
TTGATNTATATGTGGTCCCACAATATGGAAGAAACCCTGATAACACTGGT
TAAGAATATGGAGTATTACTCTCTTATGTTATGTTTAAGAAAATCAAAGT
ATGGGTACTGTTATTACCCGTCAATTGTATGATGGTCTCAATTTGGTTCA
ATTTAAATTGTAAGATCTCTTGATATATATAAGAGATTCTCTTTGTCTAA
AAAAA
back to top